Is it Going to Become a Pandemic?
Estimates of r0 are converging to ~3.0:
Our estimates of RR0 are broadly consistent with early estimates from other groups: 2.0–3.3 (Majumder and Mandl, 2020); 2.6 (uncertainty range 1.5-3.5)(Imai et al., 2020b); 2.92 (95% CI 2.28, 3.67)(Liu et al., 2020); 2.2 (90% interval: 1.4-3.8) (Riou and Althaus, 2020).
It looks like Corona is becoming a full-fledged pandemic in geographic terms, with multiple cases of human to human transmission confirmed in Germany yesterday. This has also been observed in Japan and Taiwan.
If that happened there, then surely it must have happened in other countries with close contacts to China, such as Thailand (they may not have been picked up there due to weaker epidemiological resources).
Which Countries Are Best Prepared for a Pandemic?
Historically, it seems like simple wealth, and the advantages it brings – larger state capacity (e.g. to effect quarantines), more physically robust constitutions, greater physical space (e.g. private cars, detached houses), etc. – have played a critical role. For instance, mortality during the Spanish Flu was at just 0.5% in the US and 0.5%-1.0% in the combatant states of Western Europe, but rose to 1.5% in Italy and the Balkans, and 5% in India and Indonesia.
Overall, we might expect to see a similar distribution, although weighted downwards to account for its lower mortality rates (currently ~1%, vs. 10% for the Spanish Flu).
Consequently, I expect suburbia-centered Anglo countries to do best in a global pandemic. Though the physical infrastructure might be depressive, one thing it’s good at is minimizing human contact.
Most of Western Europe might do slightly worse because of its older populations, greater reliance on public transport, and greater share of the population living in apartments.
One “perfect” solution is to just avoid contact altogether, like American Samoa managed to do during the Spanish Flu. But the only polity capable and willing to do nationwide sakoku today is Best Korea.
Maximizing the number of hospital beds per capita is usually a misallocation of resources. It was mostly done in the commie bloc because it was an easy to quantify target, but it wasn’t matched by quality training or funding for modern equipment, so real health outcomes increasingly lagged the West as the Cold War wore on.
But the one situation in which too many hospital beds would come in handy is in a large epidemic.
As one can see, Russia and many East European countries – and the Germanies – have three times the hospital beds per capita as many countries in Western Europe, where this indicator has been “rationalized” for a longer time period.
So for once there’s a Soviet legacy that’s actually good for a change.
In terms of wealth and healthcare resources, China would be broadly in this category.
India and the Third World in general seems screwed – not just because of that, but because both state capacity and competence are much lower than in the Global North. E.g., an observer from Nepal:
lol, that sounds bad but you are correct mate, i am in Nepal and we have confirmed here and he was released back into Kathmandu before the results were back from HongKong (no lab here for this test) Now they are trying to trace him and his family but no addresses here so he is fred from this part of town etc…. Shockingly inept of them to allow him to leave but still, yeah India and Nepal have open border with tens of thousands crossing openly daily, gonna be testing when it starts to spread cos the lack of hygiene and numbers of people crammed into anywhere is the perfect breeding ground.
With this going down in Nepal, it’s surely on a matter of time before it spreads to India. Now that will be a true nightmare, as it’s got almost ten times fewer hospital beds than China (and yet Wuhan’s are strained enough as it is), and people are much less robust (e.g. child malnutrition in India comparable to S.S. Africa).
If this does go global, I expect India to eventually accrue many more deaths per capita than China – which will in turn have many more deaths than the West. Eastern Europe, including Russia, would be somewhere in between China and the Western countries.
When can we expect Corona to start getting noticed abroad?
(if control measures don’t work and it retains its contagiousness).
The geographic distribution of confirmed cases of Corona to date correspond well to the intensity of air travel with China/estimated risk of contagion:
It took about 1.5 months for the epidemic in Wuhan to flare up to the point at which the authorities decided to quarantine it. On the one hand, authorities everywhere are now aware of Corona, and preparing countermeasures. On the other hand, the Wuhan crisis began with one Patient Zero, whereas cities elsewhere may get multiple infected visitors from China. So perhaps allow 2 months for major cities with links to China to get to that state, i.e. from around mid-March to early April.
Isn’t it just like the flu?
Many people have this weird propensity to either dismiss this as a complete nothingburger, often based on a lack of understanding of exponential growth (e.g. it’s only 20 50 100 deaths so far, you do know China has a billion people lol), while others spin up equally ridiculous apocalyptic vistas comparing it to the Black Death.
So here are some comparative statistics based on the flu, something we’re all familiar with:
- Mortality from ordinary flu is 0.01% (1/10,000), heavily loaded towards older people.
- Mortality from Corona is ~1%, i.e. take the one concrete number we have (mortality = 15% for the first 41 confirmed cases), and adjust downwards by the number of unregistered cases (90%+). That said, we don’t really know, and this could be off the mark by up to an order of magnitude either way. Like flu, heavily loaded towards the elderly.
So ordinary flu and Corona are not comparable in scale. It is very understandable to want to avoid experiencing the risk equivalent of ~100 flus, regardless of age.
For comparison, if you spend your entire life (24/7, 365 days a year) flying on modern commercial airliners, you will have just a 0.1% chance of dying in a crash. It would also quicker and less painful.
Ultimately, the Chinese authorities are not particularly sentimental, and would not have quarantined the population of Spain and slowed their GDP growth over a nothingburger.



Please keep off topic posts to the current Open Thread.
If you are new to my work, start here.
I completely agree, though just to make sure, there could be a pandemic equally (or more) devastating as the Black Death, but it won’t be this one. I think the 1% mortality figure is probably not far off the mark, though I’d put my estimate somewhat higher, maybe 2%, with the understanding that it could be considerably lower or higher, maybe in the 0.5-10% range.
Regarding USA it is interesting and conflicting mix of circumstances as it has most state of the art medical technologies, stuff and educated people, but on the other hand, costs of the healthcare even with insurance are incredibly expensive. Most of the common folk in the US has no savings or are up to the eyballs in debt, so most likely would be working till the moment they feel too much dizzy from high fever thus spreading the virus unabated.
No, this is really a nothingburger, so how long will it take to prove which side is correct here?
What is your definition of a nothingburger?
Same as the Ebolo, Sars, etc, scares.
In what sense? Obviously the economic impact is already bigger, and more people are infected. SARS killed more people so far, but it’s likely going to change. I’d also expect way more people to be affected outside China.
But it’s not going to be the Black Death, sure.
Karlin truly under-estimates India.
Once state capacity collapses worldwide due to Corona-chan then Indians have advantage even over africans for how to live under anarchy.
Also, I’m pretty sure Corona-chan will just get asked for bobs & vagene and leave.
So for once there’s a Soviet legacy that’s actually good for a change.
Who are you and what is the demanded ransom for getting AK released?
Its just for this one time.
Will sales of Corona increase or decrease? Should one have immediately bought stock?
I think sales will increase.
I have to the opposite view, if a true pandemic apocalypse happens, then Africans will have the advantage. This is simply because the lower the level of civilization the less of a collapse, Africans being the lowest means their anarchy will not look too different what they currently have.
On that topic how well would Russians handle the apocalypse?
Even if this thing does kill 100 million people this year, the lights are not going to go out or anything like that. A mortality of a 100 million is comparable to the Spanish Flu of 1918 and the lights did not go out then. The economic impact will be nasty, however. The airlines that operate flights between the U.S. and China are already feeling the impact.
The disproportional number of fatalities will be in the developing world (formerly known as the third world) because this is alway the case with pandemics. The poor always die in larger numbers than the rich. OTOH, the developed countries have a higher proportion of old people, who tend to become victims of such infectious agents.
Probably the usual way: inept until the unimaginable catastrophe happens, then suddenly wonderfully concentrating their minds and managing a truly impressive response from then on.
Many victory parades will be had ever afterward, too.
Corona being no worse than the flu isn’t nothing, either, if we end up having to deal with a corona season alongside a flu season. Particularly if it retains a substantially higher mortality rate, albeit one weighted heavily towards the elderly.
On the plus side, bringing back the old persons old friend would cut short a lot of suffering, and save a lot of money on care home and medical fees. I think people would adjust quite easily to the top 0.25% of the population dying each year as the latest corona strains sweep through.
I wonder how the following observations might affect your calculations:
The United States and most Western countries now have poor ability to manufacture testing equipment. Is it reasonable to expect severe diagnostic shortages once this thing explodes in the West? I don’t really see how everyone can be tested. Likely, they’ll soon run out during a pandemic and the disease will further get out of control.
Millions of Americans do not have healthcare or can’t afford to see a physician. Many of those people also have limited savings and will not be able to avoid work during a severe pandemic; therefore, there may be a latent reservoir of the virus that hangs around infecting others for months despite quarantine efforts among the better educated and wealthy. Those people will refuse to see a doctor or stay home, perhaps because they are unable to, and will continue spreading it as a result. This is when a UBI would have been beneficial.
My own impression, perhaps flawed, of the situation is that the West has acted with almost criminal incompetence.
First: They should have immediately ceased all air travel to and from China once this was revealed to be a corona virus – a family of extremely infectious airborne viruses compared with something more blood-borne, and therefore, less infectious like Ebola. They didn’t. Worse, the excuse many health officials made on American television concerned lost revenues from tourism, etc. They prioritized money over public health, yet another example of corporate interest overriding public interest in the United States. IMHO, it was unnecessary to wait for additional information. The presence of an unknown infectious agent from a family of infectious viruses would have been enough for me to close the border temporarily. I’m a big fan of overreacting as opposed to underreacting.
Further, this failure repeats the same fallacy made before the September 11th terrorist attacks: fear over lost revenue resulted in negligence that lead to a far greater loss of revenue than if they had simply prepared in advance. In the case of the 9/11 attacks, airlines were warned of a possible hijacking scenario involving breaking the cabin door and taking control of the plane. They were asked to reinforce these doors, something now routinely done (result: zero American hijackings since), but rejected the idea on the grounds that it would cost too much money – a few million dollars, one CEO’s annual paycheck. In the aftermath, lost revenues were substantially greater than if they had simply spent the money on preparation.
Isolation would not have fully stopped the spread of Corona, but perhaps it could have slowed it enough for the government to stock up on PPE and diagnostic tests. Also, it could have bought time to come up with a vaccine. Even if this fizzles out, it will be a demonstration of the inadequacy of current procedures (and Western government human capital) should a lethal pandemic actually occur.
CNBC Former Ebola czar cites economy as reason for not stopping China flights.
https://www.youtube.com/watch?v=4Rw1ElEpkUo
ABC News (Australia) Australia’s chief medical official claims all planes from China will be met with border security and they will … pass out leaflets to passengers before letting them go into the population, as long as they don’t show symptoms such as a fever or cough. Previously, they weren’t even doing that – just handing out leaflets in airports with no checks.
https://www.youtube.com/watch?v=iJMwZcJJAuw
Channel 4 News Deputy Director Public Health England claims threat to UK low and Corona may not be a concern if the Chinese can stamp it out there. Error: assuming SARS and Corona have equal transmissibility based on essentially no evidence.
https://www.youtube.com/watch?v=4C8CptPlllQ
*Lots of other videos available. The funniest ones involve public health officials bragging about how well prepared they are. I guess we’ll find out soon enough.
Second: They overstated their preparedness to the public. Across the Western world, nearly everyone involved with a national health service from Australia to the UK to the United States claimed they were “well prepared”. Check YouTube. Sky News, BBC, CNBC. They all say the same thing. The reality is that none of them had factored in the questions I raised above – availability of PPE and diagnostic testing, hospital space, intubation equipment availability for severe respiratory distress patients, etc. My guess is that they will find out shortly just how ill prepared they are.
Sky News UK Home Secretary claims they are “taking all the right measures”.
https://www.youtube.com/watch?v=lHEUtoMBtT8
Third: They made the foolish assumption that this corona virus acted as similar viruses do. Namely, they assumed it only spreads when symptoms present. Thus, there were stories of Americans arriving from China and being screened with an ultimately ineffectual thermometer, being cleared, and then being allowed to just waltz into the general population. In Australia, during the first few days they weren’t even doing to that – just handing out flyers to people and allowing them to walk out of the airport. Criminal idiocy.
Fourth: They allowed propaganda to spread on television; they claimed this was nothing, that it was like SARS which was contained, despite this virus being far more infectious; they claimed the flu was worse than Corona when we actually don’t know enough in this early stage to determine that with any certainty. The death toll from this could be 2 – 5x higher.
At the very least, this situation indicates the world is nowhere near capable of dealing with a severe pandemic or a weaponized pathogen, despite the propaganda to the contrary. Even if this does not turn out to be a bioweapon, Rees should stiff Pinker on that bet he made. The spirit of the argument — that bioweapons can be dangerous and the world is not prepared — strikes me as logically sound.
Bioweapon speculation:
Just to get ahead of the inevitable bioweapon talk, I’ve provided a few thoughts on the subject.
It’s interesting that the asymptomatic phase of this virus is so long – possibly 15 days – and that it spreads so widely before symptoms present. If you were going to design a bioweapon, you’d presumably make a virus that could spread in a population in just such a manner — asymptomatic until significant numbers of people have it. This would make containment impossible. Too many would be sick before those affected could be quarantined. How could this be done? My suspicion is that the virus in question would be bred / adapted to replicate in a mammal with a much lower body temperature than humans … something like a bat. This means the virus is not adapted to grow at a different, higher, body temperature, so it replicates more slowly in the host before symptoms present.
Viruses, bacteria, etc have optimal growth temperatures (example: most E. coli grow best at 37C, ~mammal body temperature, because that’s where many of them reside naturally; they are adapted to that temperature). The result is that the virus replicates in the host very slowly because humans are a non-native environment. Perhaps worse is the possibility of a mutation that adapts it to grow optimally at the human body temperature, something that could be intended if this were a weapon. Notably, Corona is an RNA virus. As such, this is a mutation-prone virus unlike DNA viruses such as herpes, for example, for which you can take one anti-viral all your life and never have to worry about resistance mutations. As such, Corona could quickly become far more lethal as the body doesn’t have time to mount an adequate defense to a much higher replication curve. If I were going to make a bioweapon, it would be an airborne RNA virus like Corona.
Although, it should be noted that none of this definitely proves Corona is a bioweapon. What you see in this virus also could easily come about via the canonical story of an ill-adapted bat / snake virus spreading to humans. Since it evolved to spread in those lower-temperature animal populations, it is not surprising that Corona spreads the way it does among humans. But perhaps, this should also probably frighten you just a little. Corona may not be well-adapted for human growth and yet is still lethal in ~1% of cases. So, what happens when there is a mutation that adapts it to grow well in humans? Well, obviously, it could suddenly become much more lethal for a period of time. Time will tell. Perhaps an inability to detect it early is a positive. Otherwise, the virus could mutate to blow up in the body overnight and infect everyone quickly before it is snuffed out.
White noise syndrome in bats: it’s a fungal infection that spreads during bat hibernation because bats have a much lower body temperature than most other mammals like humans. Interestingly, this lower body temperature is also why many opossums are immune to the rabies virus: the virus is adapted to replicate in organisms with much higher body temperatures like cats and deer, so it’s not able to replicate efficiently in opossums which have relatively low body temperatures compared with other mammals.
White noise syndrome (fungal infection):
“It preferably grows in the 4–15 °C range (39–59 °F) and will not grow at temperatures above 20 °C (68 °F). It is cold loving or psychrophilic.”
https://en.wikipedia.org/wiki/White-nose_syndrome
Looks like another SARS right now to me, which is tragic but nothing outside the normal. But I guess we will find out in a few months whether this sucker mutates and causes the dead to rise.
Apparently Chinese zombies are fast zombies that drink blood and hop everywhere, they do not shamble and are not obligate brainsovores. So we will definitely know if Corona-chan is the culprit. Undead caused by indigenous viruses in the west do not do kung fu. It’s a key diagnostic.
https://www.youtube.com/watch?v=56Zvquhww80
IMO, if China were serious about bioweapons, then they would have a bigger nuclear arsenal.
That does not necessarily mean that they don’t have an academic program, one largely concerned with defense. Aren’t they really the only country to have been militarily targeted with bioweapons in modern times?
Still, I think the most likely explanation is open-air chicken farming.
It appears that deaths from this virus will be a great test of the competence of nations to deal with challenges.
I suspect that India & the Anglosphere (especially “free market competitive” USA) will be shown to be overrated.
I expect that the rich will work at home, and the poor will continue to go to work until they can hardly stand. So perhaps the rich will flatter themselves that they right-sized the labor force.
I’m skeptical of this.
The Third Pandemic wasn’t that impressive. Some people blame the strain, but, IMO, it is more likely down to knowledge of sanitation and the germ-theory of disease.
Another big factor is food. Famine causes disease, without famine you have less major outbreaks of disease.
Still, it is an interesting question what might happen in a nuclear war, when infrastructure would likely be smashed.
The flu tends to infect between 5 and 20 percent. CV is easier to catch, so say 20 percent (conservative estimate).
CV kills about 1 percent (conservative estimate).
CV will kill 0.2 percent of world population, so about 20 million (conservative estimate).
You have no idea what the size of their nuclear arsenal is. The FAS estimate could be off by an order of magnitude or more.
It’s been in the headlines a couple of weeks and so far only killed in the 10s. That is plenty of time for people who were infected when we first heard about it to recover. Coronavirus is so far very effective at killing GDP growth.
That’s true, there are other estimates that range much higher, but I think China would advertise it if they had a bigger stockpile. There’s deterrence value in bragging.
Claims are meaningless. If they claim 5000 warheads, how would you be able to verify their claim? And, indeed, given their prowess at resource extraction and bulk manufacturing, such a claim could not be dismissed out of hand!
The Chinese would gain nothing, and may stand to lose a great deal, by blustering in front of USG. Whereas, by building bombs in silence, they would avoid or postpone another cold war, and would gain in strength and power just as the US slides into terminal sclerotic decline. The best strategy for China is therefore to speak very softly, but build a big stick in the form of nuclear and missile deterrence. It is very likely that this is the strategy they are following.
“There’s deterrence value in bragging.” – It did not work for Saddam Hussein. It depends who is your bragging target.
An average R0 of 3.0 is close to SARS (R0=2-5). So far I don’t see any compelling evidence that asymptomatic transmission during the incubation period is such a big problem. So why does it spread much faster than SARS so far? Maybe that’s because the coronavirus has not caused severe-enough symptoms and high-enough mortality rate like the SARS did, so people have not been scared into self-imposed quarantine or seeking help early enough, yet.
Saddam did not understand how aggressive neocons are. But I think his eyes would be opened by now, even if Iraq had never been attacked.
But if you have a population over a billion. If you’ve had nuclear test detonations, and the most annual rocket launches, for more than one year running, then you are in a different class than a small Arab country.
Interesting thread on how East Asians appear to be at greater risk, which would lend more support to the US bioweapon theory:
https://twitter.com/HarmlessYardDog/status/1222618700181917699
https://twitter.com/ofaltundal/status/1222652478686224388?s=20
Pretty clear the next country to watch is Thailand, a developing country test case too, huge winter tourist destination as well.
Did you notice the rate of infection decreased from 1765 (1/26/2026-1/27/2020) to 1458 (1/27/2020-1/28/2020), although it doesn’t mean anything at this point yet.
This won’t be a Gray Death. It’s as weak titty as society today.
Life is boring…
After headline-making news about rising SARS, Zika, Ebola, Swine Flu, Bird Flu, Chagas (perhaps I forgot some) epidemics, I am skeptical of the news. There is no doubt the possibility of an eventual epidemic and with the high population density and worldwide travel in today’s world even of a pandemic to occur someday – yet the regular appearance of these dire sensations makes me wary of the news.
It seems to be slowing down now. No longer following the exponential model.
https://twitter.com/bnodesk/status/1222649678954713093
“A comparison between eight individual samples demonstrated that the Asian male one has an extremely large number of ACE2-expressing cells in the lung.”
“We also noticed that the only Asian donor (male) has a much higher ACE2-expressing cell ratio than white and African American donors (2.50% vs. 0.47% of all cells). This might explain the observation that the new Coronavirus pandemic and previous SARS-Cov pandemic are concentrated in the Asian area.”
https://www.biorxiv.org/content/10.1101/2020.01.26.919985v1.full
The sample of n=1. They do not say that Asians are much more susceptible to 2019-nCov than whites and Africans.
I would caution this line of reasoning. Since the virus first emerged and spread in China, it follows that Corona would have to be somewhat adapted to the local Chinese population to have been able to spread in the first place since the area is almost totally homogeneous. Otherwise, it wouldn’t be in the news. This is perhaps somewhat evidenced by the virus’s long asymptomatic phase. It seems poorly adapted to replicate in humans, meaning that it’s not so surprising that it would need so many receptors to get started. This chart is not necessarily evidence of any kind of bioweapon.
Also, using this kind of pathogen as a racial bioweapon strikes me as potentially dangerous for the one who deployed the virus as it could always mutate to affect them, too. I’d be more convinced of a bioweapon if the death toll suddenly spikes up into the 30 – 50% range. Ideally, you would think, the virus should kill off the host so quickly that it does not have time to mutate and then burns out and disappears before it affects you. Otherwise, it hangs around in the population long enough for the target to detect it and retaliate or for it to affect those who deployed it.
Although, if it were a weapon, Wuhan would be a logical deployment center as it’s somewhat of a transportation hub and densely populated; the spread made easier by the local holiday season. Again though, this proves nothing. If a novel corona virus were to emerge naturally, it would still follow the same observed pattern: densely populated area, spread by mass gatherings (holiday), emerging from animal-human contact.
In some sense, Corona is demonstrative of the anthropic principle: the universe has the properties it does because you wouldn’t be here to observe it otherwise if it didn’t. Same with this virus. For it to exist, it must have certain properties that allow it to spread — the ability to infect Asians. Since it is poorly adapted to humans, it needs a host population that is most conducive to its spread, which would be the local population it evolved with. If it didn’t have certain properties (the ability to infect Asians), it wouldn’t exist for you to talk about it.
https://en.wikipedia.org/wiki/Anthropic_principle
Nonstop from Wuhan to SF about to take off:
https://flightaware.com/live/flight/CSN659/history/20200130/0710Z/ZHHH/KSFO
2017 UK: Terrorism is part of big city diverse living, get used to it.
2020 UK: Time to get user to Corona virus outbreaks
https://www.wired.com/story/opinion-we-should-deescalate-the-war-on-the-coronavirus/
8,000 people arrive each day in the United States from China.
Using the Aristotelian principle of moderation in all things (sometimes
though one should not carry moderation to extremes, lol) I think it would
be wise to partially close the border with China by limiting the flights
to, say, 2,000-3,000 arrivals a day. Of course, this would never be done
at this stage because that would be “racist.”
About 20,000-40,000 Americans die each year of regular flu, depending on
the year. Thousands of additional deaths occurred during the 2009-2010 flu
season due to the swine flu epidemic (which originated in Mexico so the extra
deaths were mostly in California). Did Obama close the border with Mexico
(or at least try to)? Of course not, because, again that would have been “racist.”
Hence a case could be made that Obama was responsible for thousands of
needless deaths.
The peak of the AIDS epidemic occurred around 1995 (but the peak of the
infections took place 10 years earlier, around 1985). I recall how in the ‘90s
James Lovelock’s Gaia Hypothesis (or Model) was bandied about to explain
the meaning of the AIDS crisis.
James Lovelock, an M.D. by education, is a genius of the first rank, Darwin of
the 20th century I’d say. Compared to him, Einstein or Freud are small change.
By the way, Lovelock will be 101 this year, and is still writing books.
Anyway, Lovelock proposed in 1970 that the atmosphere, hydrosphere, and
biosphere are a single self-regulating super-organism which maintains
homeostasis with hundreds of feedback loops. He called it Gaia, after the
Greek goddess.
By the ‘90s, biologists have realized that homo sapiens was the predator-in-chief
among animals, and was therefore endangering the rest of the flora and fauna.
In response, the Gaia system would protect itself from the human predators by
employing an army of viruses and bacteria to cull the human herd. In the ‘90s
it was still politically permissible to say that anal sex was putting humanity in
danger. Now this is verboten. By analogy one could claim that the coronavirus, etc
is a Gaia mechanism which is trying to restore equilibrium to the Gaia system.
Gaia can sense that the earth is overcrowded, and is sending armies of viruses
and bacteria to cull the human herd. China specifically attacked the
Gaia system directly by allowing its population to increase by 800 million
within only a few decades so no wonder it’s being punished for its foolish
behavior.
I think a comfortable equilibrium point both for human predators and the army of
viruses and bacteria is 2-3 billion people. Pandemics, like the Spanish flu, may
still happen but they are much less likely. Contrary to Anatoly, populations of
tens of billions of people would be a direct attack on the Gaia system, and Mother
Nature would not like it one bit. I think the best thing is to slowly and carefully
reduce our population to, say, 2.5 billion. This used to be done with wars. Now
it’s done with viruses and very low fertility rates but I think the writing is on the
wall.
When a pathogen develops in one location, it’s relatively less lethal there than it is in other areas. That’s why the Indians in the Americas were devastated by the Old World pathogens the Europeans brought over.
The question is whether another city or area gets overwhelmed like Wuhan and Hubei, we just won’t know that for another few weeks given the incubation time.
Gold price up, oil down, Asian markets dropping further.
First Confirmed case in India.
https://www.news18.com/news/india/coronavirus-outbreak-live-updates-symptoms-who-china-japan-india-ghebreyesus-wuhan-hubei-unicef-us-2478791.html
The Black Death could not be so devastating, but what makes you think the Black Death was the deadliest disease possible? I’m pretty sure there could be a much deadlier disease.
i’m still going with this not being that big of deal.
the Ebola thing was more serious, and that didn’t affect the first world much. it kept coming back, killing a few hundred africans every year or so, until westerners could finally lock it down and stamp it out.
coronavirus is less serious than that. once westerners develop a vaccine, it will go away.
if you check out the work on Ebola vaccines they were pretty interesting, especially the tobacco vaccine version, ZMapp. looks like Ervebo got to FDA approval first though.
it gets old, europeans fixing all the worlds problems so that the third world hordes can continue to multiply, and overrun us. sometimes i just wish we would lock down the borders and let those people deal with their own diseases. after saving the africans and Chinese from their stupid diseases, it’s infuriating they can use our own legal systems against us to sue us because we’re ‘racists’.
for the privilege of curing coronavirus, how many industrial and academic spies do you think China will send to the US as a thank you?
I disagree about using RNA viruses for bioweapons. Bioweapons should be easy to defend against (once you have the vaccine), so I’d rather create something like smallpox (except easier to spread and deadlier), where I’d vaccinate my own soldiers and population beforehand. That way we’d be 100% protected, while the enemy would need to develop the vaccine first. (Though maybe it wouldn’t be so hard, a pandemic lasting just a few months would be devastating enough. Especially if you created multiple such bioweapons, with multiple epidemics spreading all at once…)
China wants to avoid being seen as aggressive, while quickly building up a very strong military, set to compete with the US military. What is sure is that they have a large plutonium stockpile enough to build up a much larger nuclear force. So why didn’t they build up such a force? Either they’re waiting for some technological breakthrough (as with shipbuilding), or they are just trying to avoid attention. They might have built up a larger force than publicly admitted.
Wondering what will happen when people responsible for maintaining/controlling/repairing critical infrastructure will begin to drop ill. At the time of Spanish flu there was no such evolved technical infrastrusture yet, so the comparisons are not entirely accurate in this regard.
Also the apparent failure to contain all global pandemic will probably have political implications, maybe even CCP will collapse as situation will inevitably worsen, Trump may lose reelection because of that too, so he has incentives to paint situation as more less serious or even try to supress information for while, thus making situation even worse untill it blows up completely. If there even will be elections at all this fall, as mass panicking/riots of the masses cannot be excluded when cases in US start popping up like crazy.
Damning with very faint praise.
taken from r/worldnews/comments/eui9ui/live_thread_wuhan_coronavirus/fg06uss/
I suspect the ‘global system’ could easily handle 100 million deaths from the nCoV but could not survive a 10% plunge in GDP and the latter maybe more likely than the former.
When and if China emerges from its extended Lunar New Year ‘holiday’, there is going to be hell to pay. Hundreds of millions of people will need to withdraw money from the banking system but that same banking system will not have been generating new deposits from either business or workers during the hiatus. China’s bank reserves are no greater in 2020 than they were in 2014. We are going to see a massive run on Chinese banks.
We are in uncharted territory now. Imagine if California was Hubei? Shut down for weeks. How do you turn it back on? This has never been attempted before.
Guess we will know rather sooner than later, several months will be enough for Cali to reach Hubei infection rates.
1980s: Reagan didn’t react to HIV fast enough. Most affected: liberal gay men, disproportionately democrats.
2001: George W. Bush didn’t react fast enough to 9/11 — read books to children (as if there was anything he could have personally done at that moment). Most affected: Wall Street crowd, disproportionately neoliberal democrats.
2005: George W. Bush didn’t react fast enough to Katrina. Most affected: black Africans, disproportionately democrats.
2020: Corona containment is an overreaction. Most affected (United States): white Boomers, disproportionately conservative republicans.
See how this works? The far-left spent decades maligning Ronald Reagan in movies, television shows, and in books for his supposedly inadequate AIDS response, which I consider to be a libel on the man’s character. They 0nly cared because they — their political interests — were affected. If Corona targeted SJWs exclusively, they’d have blanketed the airwaves with coverage by now.
My opinion: no, we should not deescalate Corona containment, at least not at the moment. A temporary economic downturn can’t compare with the thousands or millions of potential deaths that would result from doing nothing … at least not morally. The psychological impact of the government simply giving up for economic reasons would also further delegitimize it in the eyes of the public. Why have this government if it doesn’t work and serves only the ruling class? Perhaps we are forced down this path at some point when the virus spreads beyond control (quickly approaching), but that does not mean we should throw caution to the wind and do nothing. It’s only prudent for us to do as much as possible to delay onset as long as possible. In the mean time, we can stock PPE, educate the public, study the virus, and work on a vaccine. If governments had reacted appropriately, perhaps this would not have gotten out of control, but they didn’t.
In any case, Corona teaches us what will happen when a deadly bioweapon is actually released:
Governments will fail to recognize the severity of the problem if it occurs in a densely-populated authoritarian country where data is limited. They will supplement lack of knowledge with assumptions about how previous viruses spread and adopt potentially inadequate containment procedures as a result. Example: American airport screeners initially relied on thermometers to check passengers, then let passengers go if they weren’t running a fever. The assumption made was that the virus, based on previous experience alone, would only spread once symptoms presented. We now know that to be — very likely — false based on our current understanding of Corona. Unfortunately, a bioweapon will be engineered such that it likewise spreads asymptomatically, so current containment procedures will fail spectacularly.
Social media will be filled with misinformation. Doomsayers will predict catastrophe (some are depraved trolls) and soothsayers will predict a nothingburger. Both sides will use incorrect data. Example: lots of people initially claimed a mortality lower than influenza; even if that turns out to be true, it was not appropriate to make such a claim early on without evidence; it could have been 10 times higher and they wouldn’t have known for certain at that moment in time.
Western governments will fail to secure borders until containment is impossible. The reasoning will likely involve lost revenues from tourism, hurt feelings, human rights, etc. Some progressives will appeal to the hurt feelings of those being quarantined as justification for ignoring it altogether. Example: https://www.youtube.com/watch?v=T-9y5TRXPQ0
Some governments will be forced by moral concerns to allow potentially infected individuals passage into their country without prior testing . My understanding is that Japan just released two people coming from China into the general population without testing them because they refused. They cited “human rights” and the Japanese acquiesced and let them waltz in. Crazy.
Health officials will offer the public a false sense of security by telling them how well-prepared they are. However, once the pathogen goes pandemic, they will quickly run out of diagnostic tests and PPE, as is happening now in some parts of China. Watch for screwy reporting in developing country on numbers infected in the coming days because they probably won’t be able to test everyone quickly. Western governments will also be vulnerable to shortages because much of the materials involved are manufactured elsewhere, so they may have inadequate stocks if they have not stored enough in advance.
If an extremely infections, potentially dangerous pathogen with high mortality arose, we now know there is almost nothing most governments can do about it. They will react too late with too little force.
Aside: my suspicion is that Western governments know they can’t withstand the economic impact of resource embargoes, which might come along with border closings if the public panics, so they are trying to ease the public into just letting the virus flow through the population. Their reasoning is that it’s a better outcome than a riot a la the aftermath of Hurricane Katrina. Western market capital governments, especially the more multicultural ones, seem remarkably fragile to me, even to the point where the whole of the population can’t be adequately protected in the midst of a crisis. Of course, developing countries will probably be hit worse by Corona than Western governments, but that’s partly down to available human capital, sanitation, population density, and inadequate resources. Who is to say that a developed first world and homogeneous country like Japan won’t respond better than the United States? Although, the “human rights” story above perhaps indicates a parity of idiocy between the two.
Dead people don’t vote but people who can’t get their money out of the bank do and with a vengeance!
I guess it depends upon what you want a bioweapon for — use on the battlefield like any ordinary armament or as a doomsday device like in a movie. The Soviets weaponized smallpox with the purpose of following up nuclear attacks such that the entire target population is destroyed afterwards. And unlike some other viruses, many RNA viruses find reservoirs like birds so that they can come back to further inflict pain on any survivors in following years. Cruel, but this kind of savagery wasn’t beyond some Cold War planners.
I’m not sure that would work. The Chinese and other advanced enemies would probably detect such an effort (or just assume it once they start dying) and retaliate with a nuclear strike, defeating the entire purpose of the bioweapon. IMO, bioweapons have limited battlefield use in modern times (but plenty of ancient examples). Conventional weapons can do the same with much less public blowback. A real bioweapon would be something like a doomsday backup in case the enemy blindsided you with a nuclear attack you didn’t see coming. It would be easily aerosolized, airborne, extremely infectious, deadly, and difficult to vaccinate against — something like a quickly evolving RNA virus. Although, there is a case for a DNA virus because, if you assume the enemy can’t vaccinate quickly enough, then the DNA virus won’t mutate to a non-lethal form as quickly as an RNA virus might.
That isn’t necessarily true. Europeans were selected for immunity / resistance over several generations. This is novel. Presumably, it has only recently entered the human population. For it to have been able to do so in the first place, it must have possessed a feature that allowed it to infect humans. The fact that Asians (speculation only) are more susceptible is not surprising considering how ill-adapted the virus is to human host replication as evidenced by the long incubation time. A high number of X in a population may be required for such an ill-adapted virus to get started in the first place. The same observation would likely be made for other groups had the virus emerged elsewhere.
We’re not in a formally declared conventional war, so all the speculation about corona being a bioweapon is in the context of unconventional, proxy, and cold wars. Nuclear and conventional weapons aren’t necessarily the appropriate comparison. Trade wars, economic sanctions, etc. would be. The coronavirus is causing economic and other disruptions, even if it doesn’t kill many people.
Virus generation times are very short. The virus is even more novel to areas outside of East Asia.
The WHO is totally useless. Had they called for a travel ban on China, the virus just might be contained there. But in the absence of it, there’s no way it’s going to be contained. It’s going to spread in the third world (possibly also to places like Hungary), and from there to the West.
In Hungary, the latest news tell me that air traffic to China is going to be closed… as soon as the need arises. The fact that the West (despite ample warnings) is still not closing air traffic is a sign that the Chinese response is not going to look all that horrible in retrospect.
You right, though.
Haven’t been around much, have you?
Cannot agree with that – it is already in the West directly from China flights and now is only going to spread further from within faster than a wildfire in dried dead forest even without third world contributions to this monumental clusterfuck.
E.g. most recent case in France where infected French doctor been in contact with a patient who came for a flu but he wasn’t confirmed, later on that patient went back to China and he got tested positive there. Let’s not forget how many patients the doctor had seen between the infected patient and until the doctor tested positive and how many people they’ve been in contact while in France.
I didn’t know about the French doctor. Yes, it’s possible that now it’s going to spread everywhere.
https://bnonews.com/index.php/2020/01/the-latest-coronavirus-cases/
Corona keeps up the pace. Interesting they have just 124 recovered, although likely will improve and is, like deaths and infected, under counted.
Well, it is difficult to understand all the differences at play.
Take smallpox. Estimate is that it killed 300 million people in the 20th century. Now that sounds impressive, but then you’ve got to ask how many of those people lived in the West? It’s not zero, but by comparison it seems pretty insignificant, and those were arguably worse conditions than today, in the early 1900s. And what’s more is that there was a weaker, mutated strain going around, variola minor, that left people walking while they were infectious and thus immunized people from the deadlier strain.
So that’s by far the two worst diseases known from history – plague and smallpox – and neither one seems like the Angel of Death in functional countries, with knowledge of the germ theory of disease.
So much has changed, it is hard to see how history is relevant – saving some big disruption, like war. For instance, it is thought that grand solar minimums often resulted in outbreaks of disease, and it has been a while since we’ve had one. Maybe, it would not be a blip today as people generally don’t huddle together for warmth anymore.
Yet another one new absolutely great(/s) case in the West of near future confirmed (about 2-4 weeks from now) contamination directly from China – two confirmed cases in Rome, Italy, visited the whole country ever since they got here from Wuhan. They’ve been here for one week and a half and were diagnosed only today. They visited like 10 provinces in the meantime.
Ain’t open borders great?
As a fucking clock with cuckoo, Trump never dissapoints, lol 🙂
https://www.politico.com/news/2020/01/30/trump-close-cooperation-china-coronavirus-109701
My theory of nuclear weapons is that you only need a moderate stockpile to act as a deterrent, since it is only necessary to scare the urban class. (since the urban class is in power). IMO, the Chinese have fixated on this strategy, for historical reasons, (they don’t have the arms race as a legacy) as well as reasons of cost effectiveness, and that includes political costs, such as world opinion. The Chinese express a non-first strike policy.
The Chinese build-up of conventional arms is more about gaining prestige among lower and middle-tier countries, and as such is effectively in a different strategic category than nuclear arms, IMO. Some of this stuff they can sell, but they can’t sell nuclear weapons.
The US and Russian stockpiles effectively are more about the capacity to commit genocide. This is the competitive legacy of a two-party arms race, and thinking that was based along single ethnic identities – Russian and white American (though I hate this term.)
If China launched on the West – they would be killing large numbers of Hispanics, Africans and Arabs. It is probably more difficult for them to contemplate, since it would alienate them to a large part of the world.
But of course, that leaves other possible targets: India and Russia. But anti-nuclear protests suggest a high global cost. As well, the Chinese economy is more integrated with the globe than the USSR’s was.
None of that is to say they don’t have the capacity, but the trends seem to be for the US and Russia’s stockpiles to decline, and partly because of this decline, I just don’t think they have the political impetus, for a nuclear arms race.
US & Russia only keep 1000 warheads active across triad due to treaties.
From that POV the few 100 other countries possess if kept active suggest more parity than raw counts.
That’s a good point. It would supposedly takes months to reactivate and mate some of these warheads.
And another thing I overlooked is that, in recent years, China has been increasing its number of ballistic subs, and those are relatively easy to count and make comparisons with, though they are said to be noisy.
Details of asymptomatic spreading are emerging:
https://www.nejm.org/doi/full/10.1056/NEJMc2001468
As could be expected, this is really infectious even early on during the incubation period.
Index patient arrives in Munich from China. On 1/20, 1/21, and 1/22 the index patient is in business meetings with patients 1 and 2.
Patients 1 and 2 end up showing symptoms by 1/24.
Patient 3 only has contact with Patient 1 on 1/20 and 1/21. This is on the same day or only one day after Patient 1 had been in contact with the index patient.
Contact with the virus and you are already contagious 24 hours later.
It perfectly explains the breakneck speeds of spreading in China so far.
Also, it means that there are such breakneck speeds of spreading going almost everywhere outside of China, just the confirmation is and will be much much lagging.
But these are mild symptoms. So maybe it’s getting less virulent at the same time as it is getting more contagious.
Hungary is taking very important steps: on the Wednesday meeting of the government, they decided to create an operative staff (headed by the interior minister) to deal with the situation. The operative staff has already started to work today. The prime minister warned against belittling the danger. He said everything that could be done has already been done, and the question is how effectively they can coordinate the necessary steps.
https://index.hu/belfold/2020/01/31/orban_viktor_kinai_koronavirus_kossuth_radio_interju/
I hope they have enough donuts and mineral water served at the meetings of the government and the operative staff. They are clearly monitoring the situation closely. I can rest assured now.
I bet you the USA doesn’t yet have a Coronavirus Emergency Operative Staff! Hungary is clearly light years ahead of others in monitoring the situation.
In other news, the 14 daily flights from China will be suspended immediately… should the need arise. The need clearly hasn’t arisen yet.
What about the Chinese tourists in Budapest? Vienna and Salzburg were yesterday filled with huge crowds of Chinese tourists, and some of these tourists wore (for some reason I do not understand) masks
NCov2019 is very very contagious and more virulent than SARS, the rates are not levelling yet (will they??)
https://i.ibb.co/ZgC9HK7/jhu0130.png
It depens upon an individual I guess, but I wouldn’t call a a fever of 39.1°C very mild for initial symptom even if possibly short term. If those German do not get worse in two-three coming weeks and begin to be tested as negative, then there is hope, but so far too early to tell.
https://www.nejm.org/doi/full/10.1056/NEJMc2001468
The seasonal flu can cause 39.1°C fever, and usually lasts longer. Though the guy might be a workaholic who goes back to work as soon as his fever is below 38°C, so maybe he didn’t really get well by the fourth day of illness.
SARS didn’t start in March 2003, it started months earlier. With 2019-NCoV, it started early December 2019.
Actually, I think just 14 flights a week from China. 14 flights a day would be impossibly high for a small airport like BUD.
That depend on availability of data. What are important are the slopes and how high they can go. At no points on the SARS curves where the respective slopes match the max slopes for NCov2019 and you are worried about where they start. With the max value of about 8500 where do you find the data point with value of 1??
https://bnonews.com/index.php/2020/01/the-latest-coronavirus-cases/
Decent number of recoveries in Thailand and Australia, seven and two respectively.
In 2002-2003 there were ≈8000 cases of SARS with fatality rate of ≈10%. NCoV2019 with lower than SARS ≈2% fatality rate but with at least an order of magnitude being more contagious will soon cause more deaths than SARS.
BTW, In Toronto in 2003 over 70% cases of SARS were acquired in hospitals.
I don´t understand what the link is about, but I would like to add that one should expect higher mortality with Corona-patients in China than elsewhere because the disease affects people in all age cohorts in China, while it primary affects middle-aged people with business ties to China in other countries.
https://jameslyonsweiler.com/2020/01/23/invite-your-public-health-officials-to-the-emergency-ipak-hpv-vaccine-science-crisis-webinar/
Virus may not be an intentional bio weapon, but it is likely genetically engineered as a vaccine against SARS.
https://jameslyonsweiler.com/2020/01/30/on-the-origins-of-the-2019-ncov-virus-wuhan-china/
https://www.linkedin.com/in/jameslyonsweiler
I was thinking that too: age cohorts. It might be a side effect of the visa selection process that it selects for healthier people, when you match for age cohorts too.
It’s to protect them selves from dirty Europeans spreading Corona Chan to them.
The first link below gives the layman’s version of the evolution of virulence. The second link is to a professional-level review paper.
The “Short-sighted evolution hypothesis” in the Wikipedia article suggests that the ease of transmission of NCov will favor those viral mutants which reproduce most rapidly, and this normally is correlated with greater virulence. This means that all measures should be, and should have been, taken to reduce the Ro, more to hold virulence evolution at bay than to eradicate the virus, which is likely impossible now.
https://en.wikipedia.org/wiki/Optimal_virulence
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4873896/
The trouble with globalism is that, with all the cheap flights, they have a ready-made excuse: it is already too late, so it would be pointless to close the border now.
One almost wishes for a scenario where it would travel slowly, killing lots of people like the Black Death (not that one really wants people to die) but just to show how morally bankrupt globalism is.
No, it’s not. The link you provided proves nothing; it’s fake news. The post deals with the ramblings of a man convinced HPV (a DNA virus spread by physical contact / fluid exchange, unlike the airborne RNA Corona virus) vaccinations increased HPV rates. Presumably, he means a weakened vaccine caused illness, which is possible in some cases. However, I believe most vaccines involving this kind of infectious agent (example: influenza) are inactivated, meaning they are viral particles rather than whole virions and are, therefore, incapable of causing viral infection or transmission. Additionally, the Corona virus is significantly different enough from SARS for this to be out of the question even if the vaccine consisted of weaken whole virions.
My guess is that “Leafy” here is actually the guy in the links he posted — probably a quack spamming a popular thread for his own financial benefit. I noticed a link for donations in the article he cited.
If you look at the first chart carefully you will notice that the infection seems spreading linearly now. I think it’s consistent with the data that during the past 5 days, the rate of infection has stabilized to a constant 2000 persons/day or so. It’s no longer spreading in an accelerated rate as in exponential spreading 5 days ago. That’s some good news.
My once-over of the link provided by Leafy:
*Layman’s explanation: the author is claiming Corona is not derived from other closely-related corona virus species. He’s attempting to ease the reader into accepting the notion that the virus is artificially constructed.
Corona doesn’t have to be monophyletic in the sense the author uses the term: two organisms derived from a single, recent common ancestor. Example: primates. Humans and chimps are both primates because they share features derived from a recent common ancestor – opposable thumbs, the whole works. Humans are not derived from chimps but rather both groups share a closely related common ancestor which had these features, so both groups now have them as well; thus, primates are a monophyletic grouping because all members share this ancestor. Same logic applies here, but it is misapplied by the author to assert something that is not true: Corona is not closely related to other viruses because it has a sequence not present in them and is, therefore, artificially constructed – most likely.
However, Corona could easily be derived from a common ancestor a couple of generations back instead of just one in a monophyletic grouping, perhaps a virus that was first in snakes and then moved to bats – or vice versa, or some other combination. That’s basically what experts are saying.
Thus, Corona would share some similar genomic sequences with bat corona viruses without necessarily being in the same grouping with them. They would still be related though a more distant ancestor just like cats and primates are if you go back far enough. Example: both have a backbone because they share a distant ancestor that had one, but primates also have something cats lack – opposable thumbs … doesn’t mean the two groups aren’t more closely related to each other than cats are to squid or chimps are to shrimp. It certainly doesn’t imply either group was artificially constructed in a laboratory. The author is arguing a definition to imply a result that is not necessarily valid.
“Related coronaviruses”
In reality, a similar sequence (encoding for a spike protein) is found in a bat corona virus. The author is using a relationship argument to inappropriately dismiss this fact. Either that or his NCBI Blast settings were incorrect. The sequence shares approximately 80% similarity with a bat virus I found in the NCBI Blast database. This is why experts believe the virus originated from bats. This is not necessarily a significant observation.
This is a bit misleading. The graph presented looks convincing prima facie, but really it isn’t. A similar graph could be constructed using any two sequences between different viruses. All this shows is that there is a segment that differs between two different viral sequences, which is an obvious result if you’re looking at two different species; they are different, by definition, because they differ genetically. Further, it’s not surprising that the sequence is novel. The spike protein contains a receptor binding protein used for cell entry. This is the portion of the virus most likely to mutate between viral strains. That’s why we don’t have a universal vaccine against influenza.
I see no reason why it shouldn’t be there. The viruses are different, so there should obviously be something in one that is not present in the other. Otherwise, they wouldn’t be different.
The author inappropriately uses the word “inserted” to imply a scientist inserted the sequence artificially. There is no evidence of that. The portion of the virus that differs between what he looked at should differ because that’s the segment most prone to mutation.
That’s not unexpected. SARS is also a corona virus. Both novel Corona and SARS show ~80% homology. The author takes something that is true and then uses it to imply something that is not true: I believe he later uses the fact to assert this outbreak is some kind of runaway SARS vaccine event. Who knows, but it’s not proved here.
https://respectfulinsolence.com/2020/01/31/2019-ncov-wuhan-outbreakdue-to-failed-coronavirus-vaccine/
This is not necessarily evidence of anything. Shuttle vectors often include sequences derived from organisms, especially viruses, because they have elements that allow them to replicate quickly, so you can make lots of stuff in laboratory. Similar sequence does not mean anything here. Probably, something from a corona virus (promoter, likely) was taken and then used to construct the shuttle in question.
*Shuttle vectors are pieces of DNA inserted into cells. Very often, the intended result is that the sequence then induces the host cell to make lots of whatever protein sequence is included in the vector. The vector will have parts that induce the cell to make lots of this protein. These DNA bits are often viral in nature because viruses have evolved to quickly replicate themselves inside your cells – a process much faster than what your cells normally do, which is one reason why viruses make you sick.
This should add fuel to “man-made” theory:
https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1.full.pdf
So…somebody made a mix of AIDS and SARS? Really nice.
According to Flight Connections – usually pretty reliable, though not always up to date – there are 12 flights per week between 5 Chinese cities and Budapest at this time of year.
I’ll give a quick clarification of what I meant by that if you didn’t understand. Imagine someone makes a family tree. You and your immediate family are included. You all have blue eyes, a family trait. Another guy, the person you thought was your sibling, is found to be adopted; you are not closely related. However, he also has blue eyes. The author of that post was essentially claiming that the presence of blue eyes in the adopted sibling is unnatural. It’s not. Even though you and this person are not in the same immediate family relationship, you do both share a distant ancestor who had blue eyes. Therefore, the observation that this trait exists in someone not closely related to you is not surprising; it is not necessarily evidence of anything strange. You don’t need to play the X-files theme just yet.
Also, the presence of a corona virus sequence in a shuttle vector (usually a circular piece of DNA known as a plasmid) is not surprising. Viruses have sequences that allow them to replicate far faster than their mammalian equivalents, on average. These segments are taken from viruses and inserted into vectors so that scientists can induce host cells to quickly make lots of protein, the basis for enzymes and other things, in the laboratory. They can then collect this stuff when finished and study it or put it to use in medical treatments. Corona viruses have been studied for a long time and they are fast replicating, so it makes sense that there would be very old plasmids available that utilized them. That’s nothing to be alarmed about. The poster on that blog was connecting dots that shouldn’t be connected.
That could be ominous. However, it need not be. The situation may depend on just how short this sequence is. There are so many sequences in the NCBI database, that any short search term will yield lots of erroneous similarities. Take this with a grain of salt until more data comes in. Then play the X-files theme.
China coronavirus: Beijing confirms use of anti-HIV drugs at some hospitals
https://www.scmp.com/news/china/society/article/3047667/china-coronavirus-beijing-confirms-use-anti-hiv-drugs-some
… HIV-1 gp120 is (or was) a target for drug / vaccine research, if I recall correctly. If it’s true this is an escaped experiment gone wrong, foolish Western governments who wouldn’t close their borders have some ‘splaining to do; criminal incompetence. Is that why Canada and Australia and the US are suddenly quarantining people on military bases? How could the Chinese know to use these drugs so quickly?
My guess (wild speculation): Putting elements of this glycoprotein on a virus and then infecting animals might be one way to generate a novel antibody for use in HIV treatments. The animal then escapes into a nearby wet market and … X-files theme.
Not the guy who wrote the article. Appreciate the rundown.
Anyway, here is some analysis concerning the HIV connection.
https://mobile.twitter.com/trvrb/status/1223337991168380928
Seems more trustworthy than my last post.
Saddam’s error wasn’t WMD’s (or the lack of them) and associated bragging rights; Saddam de-Dollarised Iraqi oil trade, opting for the Euro, and in fact the timing was spectacularly good, as the move was right around the time the Euro reached its all time lows against the Dollar, netting a few hundred millions of additional gains. Khadaffi made the same mistake and paid the same price
https://biorxiv-cache.s3-us-west-2.amazonaws.com/2020.01.30.927871.full.pdf
Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag
“As none of these 4 inserts are present in any other coronavirus, the genomic region encoding these inserts represent ideal candidates for designing primers that can distinguish 2019-nCoV from other coronaviruses.”
“This uncanny similarity of novel inserts in the 2019- nCoV spike protein to HIV-1 gp120 and Gag is unlikely to be fortuitous. Further, 3D modelling suggests that atleast 3 of the unique inserts which are non-contiguous in the primary protein sequence of the 2019-nCoV spike glycoprotein converge to constitute the key components of the receptor binding site. Of note, all the 4 inserts have pI values of around 10 that may facilitate virus-host interactions. Taken together, our findings suggest unconventional evolution of 2019-nCoV that warrants further investigation.”
Well said overall.
To this point …
Half the battle is minimising contact of contaminated hands with vulnerable mucous membranes, like the mouth, nostrils, and eyelids; face masks help reduce the number of risky contacts that might otherwise subconciously happen if the mask was not in the way.
https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30260-9/fulltext
Nowcasting and forecasting the potential domestic and international spread of the 2019-nCoV outbreak originating in Wuhan, China: a modelling study
In our baseline scenario, we estimated that the basic reproductive number for 2019-nCoV was 2·68 (95% CrI 2·47–2·86) and that 75 815 individuals (95% CrI 37 304–130 330) have been infected in Wuhan as of Jan 25, 2020. The epidemic doubling time was 6·4 days (95% CrI 5·8–7·1). We estimated that in the baseline scenario, Chongqing, Beijing, Shanghai, Guangzhou, and Shenzhen had imported 461 (95% CrI 227–805), 113 (57–193), 98 (49–168), 111 (56–191), and 80 (40–139) infections from Wuhan, respectively. If the transmissibility of 2019-nCoV were similar everywhere domestically and over time, we inferred that epidemics are already growing exponentially in multiple major cities of China with a lag time behind the Wuhan outbreak of about 1–2 weeks.
So essentially whole of China soon will be one big Wuhan, where it seems people are begining to drop dead at the middle of the walk in street. And the rest of the world too, just a little bit later.
Certainly sounds plausible. What would be the political fallout, if a horrible epidemic turns out to have come out of a Chinese lab due to negligence..? Will there be calls for reparations?
It’s pretty much a Chernobyl moment for the Chinese regime. But I don’t think their instincts will be to apologize or anything. There will be local scapegoats, there will be repression, and depending on the circumstances, they might point their fingers outwards, accusing the US (who else?) of biological warfare. The result of which could only be a fully fledged New Cold War, and the Great Bifurcation as Karlin put it.
Some are going to be cancelled next week, probably due to reduced demand, which is a kind of automatic quarantine.
A lot of speculations here, but early Chinese work revealed that the new coronavirus is 96% identical to a bat coronavirus. It’s also quite similar to the SARS corona virus, which is also suspected to come from bats initially.
https://www.biorxiv.org/content/10.1101/2020.01.22.914952v1.full.pdf
I know nothing of this. Certainly both explanations sound pretty plausible to me.
Relative to virtually any mammalian cell, yes. However, viral generation times may differ between species. My guess is that Corona is not as well-adapted to human cell replication compared to something like influenza (though this need not necessarily be true — just a wild guess), thus the occasionally long latency period between infection and the appearance of symptoms. That could also be why some people initially test negative (low viral load) and then test positive later; the sensitivity of the diagnostic test isn’t sufficient with low viral loads, just as some AIDS patients can test negative if they’ve been on a long term anti-retroviral cocktail. If true, I would speculate this came about from the virus being adapted for replication in a non-human animal — a snake, a bat, or some other mammal — before jumping to patient zero.
Death scenario 1: host dies from weakened immune system (old, medical complications). Most likely.
Death scenario 2: cytokine storm (immune system overreaction, not really seen here). Unlikely in most cases.
X-files death scenario 3: the virus, despite poor replication (which allows for a long infection period before symptoms present), is aided by an extremely efficient receptor binding protein (explains high r0?) engineered to infect animals or eukaryotic cell cultures in lab, builds up and then overwhelms the host because the host can’t quickly generate an effective antibody against it:
This latter scenario — admittedly outlandish, unlikely, and totally conspiratorial — will likely be discounted if the death toll stays around 1 – 2% over the next few weeks. If, however, patients linger on and die at rates of 15 – 30%, well then … that’d be interesting information to know. Does anyone know how many Chinese have provably, and totally, recovered from Corona?
https://www.youtube.com/watch?v=Vpqffgak7To
Aside: GP120 sounds like a cool title for a future pandemic movie or book. Wish Crichton were still around … although he already did that once in the Andromeda Strain. Any ideas on what Corona will eventually be called? GP120? Andromeda?
If Iraq was incapable of developing nuclear weapons (as seems likely to me), then one wonders how successful their bio-weapons program would have been, if deployed. Probably not very successful.
This is the most likely origin, certainly. It’s pretty interesting, though, that people are so atomized these days that their only social contact is through video games and apocalypse mongering. I guess I should stop indulging it myself. It’s been fun, though.
Just to clarify, my first impression of the study in question is that the reported conclusion is wrong and the association with HIV likely spurious. Admittedly, though, I haven’t had time to actually read the paper, so I’m just guessing. You should keep in mind that there are alternative explanations for their findings that don’t indicate any kind of escaped research pathogen or bioweapon. Most likely, the canonical story is correct (my guess: 95% probability).
The NCBI database is huge; it stores an enormous number of genomic sequences from basically every kind of organism you can think of – mammals, fish, plants, viruses, bacteria, etc. It’s a useful tool because you can use it to search for matching sequences given an unknown sequence you have on hand. Want to know what you have in the lab? Sequence it and then compare it with a database. But this tool is fickle. You have to know what you’re doing: you have to understand how to choose the appropriate search parameters and you have to realize it’s not a complete database; not every organism is included.
Therefore, it is possible a searched and matched sequence does not actually indicate relationship if another organism shares the same sequence but has not yet been placed into the database. HIV is well-studied, so obviously its sequence should be there. Just because you find a match with it, however, that does not necessarily indicate relationship (it doesn’t mean that someone yanked out a sequence from HIV and placed it into Corona – necessarily). More study would be required before drawing that conclusion.
Also, the paper admits they searched for short protein sequences. If the search was for a small sequence, the results could be misleading. It’s akin to the old monkey and typewriter tale: give a monkey a typewriter and an infinite number of paper sheets and time, and eventually it will type out Shakespeare. In this case, there are only a handful of letters in the database, all arranged in different sequences. Short sequences will match multiple organisms. Say I search for “ATG” (DNA). That sequence will yield a huge number of matches across an enormous number of unrelated organisms – doesn’t mean any of them are related to my sequence in the lab. The point is the following: the more letters I have, the lower the probability that my sequence matches something it doesn’t belong to.
Search for:
ATTTATTCGCGCGCACGCATCGCGCATGCGCGGATATGTGTCGCGCCGCGATTCTTTCTACACACTATCTCATCAAATTTCCCGGGCGCTATGCTATTGTGTCTATCGT etc
…. and you’re far less likely to get a spurious result because fewer and fewer organisms will perfectly match the more letters you include. Similar example: what’s the probability of flipping heads on a coin? Well, 50%. Heads twice? 0.5 x 0.5 = 0.25 (25%). What about heads 8 times in a row? Less than one percent. Why? because HHHHHHHH is far less likely than a random sequence like HTHTHHHH or TTTTHHHH etc. The more letters I have, the more specific the match; the less the likelihood of an incorrect one. Although, even with that knowledge, you still have to know what you’re doing and how to interpret results. Moral of the story: science is not always clear cut; there is sometimes a human element beyond the data.
The paper’s authors are possibly just misinterpreting their results. There’s probably at least one other explanation I could think of for their results if I put my mind to it. I’m sure others could find other flaws, perhaps interpretational or methodological.
As for the anti-retroviral medication the Chinese are using, it’s likely they are simply desperate in a bad situation and are testing everything they can throw at this ailment. I don’t oppose giving it a try. I might also suggest medications like lithium. It’s effective with ameliorating some DNA viral outbreaks like herpes; although, I predict the efficacy here is probably zero. But hey, why not if you’re desperate?
Ignore the apocalypse mongering. It was just a bit of temporary fun, like a nervous laughter; TV sucks these days so I often stray into more imaginative grounds. I’m not downplaying Corona’s potential impact though, which I suspect will be very bad in the third world (but nowhere near as bad as the Spanish flu). I also stand by my statements that Corona has demonstrated some level of Western healthcare incompetence. This virus shred through standard containment practices like a hot knife through butter – the situation made worse by bad civilian leadership and indecisiveness. Even if Corona blows over, you should be worried about the response here. When TS really hits TF, we aren’t going to be able to stop it, not like this. It’ll be 12 Monkeys.
No. I fell into the same track after seeing little change for 4 readings in 35 hours but then the delayed effects of the Wuhan exodus before the lock down and on the lesser prepared regions kicked in after the incubation period.
China should have locked down Wuhan earlier. The indecision resulted in the reported 5 million exodus from Wuhan before the lock down. From the data it can be seen that the exodus might have broken the exponential growth from Wuhan, but that might have transferred (sudden jump) to about 2000 new confirmed cases to the rest of the country a few days later. The incubation period is about 5 days. The exodus spreaders were descending on lesser prepared local populations and hence the spike elsewhere but not at Wuhan/Hubei.
https://i.ibb.co/gyKQW2P/jhulock2.png
Here’s an interesting article on some of the stuff Dr. Charles Lieber was working on 15 years ago. Dr. Lieber is the Harvard chemist who was arrested a few days ago for ties to Wuhan. He was working on virus detectors that could detect a single virus and catch viral outbreaks and bioweapon attacks early. A possibility is that his work with Wuhan enabled China to catch a US bioweapon attack relatively early on, mitigating its impact to a degree. This relatively quick response would have alerted the US and aroused suspicion, and so the feds came down on Lieber just days after this hits the news.
“Sensor detects, identifies single viruses
Early warning for disease and bioterrorism”
https://news.harvard.edu/gazette/story/2004/10/sensor-detects-identifies-single-viruses/
Perhaps a better example:
Consider the word “the”. Open the first book you see and search through it to find the first instance of the word. You’ll get to it pretty fast. You’ll also notice that it repeats a huge number of times. The probability of finding that word is very high because it is so ubiquitous (partly because it’s short). Now consider the following sentence: “In the 2,000 year prehistory of psychology, which was dominated by Platonic philosophy and Christian theology, the cognitive aspect of mind was identified with the soul, and conceived of as a perfect, immaterial, universal attribute of humans.” How often do you think you’d find that combination of letters and words, even if you searched your entire – assuredly large – library? Probably once, if you’re lucky.
Similarly, a short nucleotide or protein sequence can be found in NCBI quite easily if your search parameters are not correct. The database is huge and there are only a limited number of letters available (representing nucleotides or amino acids). A much longer sequence is less likely to be found just like an entire sentence from a wordy book probably won’t be found in any other book. The researchers here probably just misinterpreted the significance of their finding just as if I found a single instance of the word “the” and got excited because the same word also appears in a famous sonnet, perhaps thinking I had rediscovered a part of it when really it’s all just coincidence because the word appears everywhere.
Here are the official infection rate in China during the past few days (the numbers are new cases each day):
1/26: 769
1/27: 1,771
1/28: 1,459
1/29: 1,737
1/30: 1,982
1/31: 2,102
http://www.nhc.gov.cn/xcs/xxgzbd/gzbd_index.shtml (try google full-page translation)
https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports/
It seems that the infection becomes linear starting on Jan. 27. See the chart on the left side:
https://www.worldometers.info/coronavirus/
I’m aware of the new Lancet article someone linked to that suggests that exponential spread may yet to occur. So let’s wait and see.
btw, if this new shit is so super contagious as it seems from German cases then both Chinese vicepremier and head of WHO who were last week in Wuhan should have been infected too. Chinese will likely to be silent about this, but outbreak in WHO headquarters or the head of it getting ill should be known soon if this will happen.
I think it’s too early. The number of new cases dropped on January 28, but it has happened before on January 22. If you take a look at the province level data, you will find such drops and long seeming stagnant periods everywhere. I’d wait a couple of weeks before declaring it under control.
https://en.wikipedia.org/wiki/Timeline_of_the_2019%E2%80%9320_Wuhan_coronavirus_outbreak?wprov=sfti1
And don’t forget that they basically shut the whole country down last week. How long can they keep it in shutdown? It’s not very sustainable, so they will need to see reductions in cases soon or else the rate of increase will pick up again.
I don’t think it’s that super-contagious. Basically you can avoid infections (there’s always a very low probability, but not much) by never touching your face, constantly washing or disinfecting your hands, and keeping contact with infected people to a minimum, especially avoiding direct physical contact. The majority of people in Wuhan don’t have it.
Really hope so, but so far it seems everyone that has been there comes out infected, despite presumably knowing these simple rules:
https://www.nytimes.com/2020/02/01/world/asia/coronavirus-china.html
OMG
is it true this virus has parts of HIV in it?
Russian health ministry recommends a dug called Lopinavir/ritonavir to treat this infection. According to Wikipedia Lopinavir/ritonavir is commonly used to treat HIV!
As a result, he was probably not very careful. Do you religiously wash your hands every time you after visiting a cancer patient? Doctors probably do, but probably not nearly as carefully as after visiting a patient with a highly contagious infectious disease.
Some people are already celebrating the slowdown of the growth rates of the epidemic. I said it was premature, because the extreme lockdown imposed on most Chinese provinces was not sustainable, and once it was eased out of necessity, the growth of new cases could pick up. Here’s an example of how unsustainable it is:
https://www.bloomberg.com/news/articles/2020-01-30/300-million-chickens-are-at-edge-of-death-on-hubei-lockdown
It’s clear that some of the restrictions will have to be eased soon.
There are ten provinces other than Hubei with over 200 acknowledged and identified cases. Apart from Tibet they all look like a few days from a pandemic.
What about HIV connection? Why are HIV drugs used to treat the infection?
https://twitter.com/japantimes/status/1221519439386087424
I read that parts from HIV are present in the virus structure. This is no ordinary flu.
It appears that my accolades in honor of James Lovelock, inventor/discoverer of
the Gaia model, were greeted with skepticism. Let me explain. I believe that
biologists, who by definition study systems at a much higher level of organizational
complexity than physicists, deserve more recognition than the latter but in our
culture the reverse is true.
The physical sciences (physics, chemistry, astronomy, geology, and their applications
to engineering) or death sciences as Sailer calls them, address the lowest level of
organizational complexity in nature: non-living matter. Physics looks complex only
because it’s so simple – it’s so simple that it can be reduced to mathematics (which
most people find forbiddingly difficult). Hence the physicists talk about the unreason-
able effectiveness of mathematics when applied to physics (and engineering). The same
cannot be done with life sciences (biomedical sciences). You open a textbook of
biology, and see very little math beyond probability and statistics. Many have tried
to reduce Darwin-Wallace’s Principle of Natural Selection to a set of differential
equations, analogous to the equations of Newtonian Dynamics. The results have
been less than satisfactory. In life sciences we begin to deal with complex EMERGENT
systems (such as cells, organs, ecosystems, and more generally, rivers, mountains,
cities, the Internet, …), and nobody knows how to deal with them because they are
history-dependent (this behavior appears even in physics in the form of hysteresis).
Hence anyone, such as Lovelock, who can develop models involving complex
feedback loops connecting the biosphere to the rest of our environment, deserves
more recognition. Full disclosure: I attended his lecture at my university a few years
ago. They couldn’t find a lecture room big enough to accomodate all the faculty
and students who wanted to hear the man. I was impressed enough to go out and
buy several books to get better acquainted with his model.
For more info about the approach that privileges living matter over nonliving
matter, i.e., biology over physics, I recommend the book Biocentrism by Robert
Lanza, M.D. Whitehead’s Process Philosophy is also relevant. Physicists have
succeeded in describing the four fundamental interactions in terms of beautiful
equations of (quantum) field theory. Hence to physicists nature appears beautiful,
elegant, and even godlike due to the rationality imbedded in the laws of physics.
No such description has been found in biology. Hence to a biologist nature appears
to a large extent chaotic, random, cruel, unpredictable, and irrational – viruses
and bacteria are certainly in this category – a much more pessimistic outlook.
Reading comments from No. 98 through 118 in this thread should shed some preliminary blurry light on this issue.
Of course the Chinese are taking precautions now and are better prepared so spread should be slowed.
This HIV gibberish is utter nonsense and has been debunked.
My knowledge of virology is close to zero, but the current consensus view seems to be that it’s a simple bat virus. The findings of similarities to HIV are premature, and probably won’t be confirmed later.
But why are they using HIV drugs to treat it? And China has been using this treatment for over a week – somehow they figured out right away what this virus is and how to treat it…
The fact that zerohedge was banned from Twitter over this suggests that some kind of cover-up is under way.
Just a speculation about possible natural causes – RNA viruses are fast mutating, so maybe one of those first infected was also having HIV, therefore batvirus managed to merge somehow with HIV too?
There is a lot of gibberish in there. Someone suggested HIV drugs are used simply “out of desperation”. I find this explanation lacking. Common sense suggests that if this thing responds to HIV treatment, it should be at least somewhat similar to HIV.
Somehow Chinese knew it from the beginning. They don’t just try every available drug on these patients, do they?
It is quite believable that Chinese commies simply fucked up incredibly with their experiments at Wuhan biolab and this is the result, therefore they knew much more from begining. RF blogger el murid suggested yesterday they were infecting prisoners for experimentation but created such stealthy virus strain that couldn’t even contain as those first infected were Wuhan lab workers. Were did he get those ideas is not clear as he is prone to posting a lot of nonsense too, so have a grain of salt 😉
Atlantic Council has wanted to silence them for a long time.
http://mediaarchives.gsradio.net/rense/special/rense_013020_hr3.mp3
Best interview that analyses the different clusters and the virus itself.
A few thoughts about China. A couple of years ago I described China in this
blog as a failed civilization. Given the events of the last few months, I feel
fully vindicated:
China has displayed an embarrassing level of incompetence for all the world
to see. This endangers its status as a reliable business partner.
Two new factors: (1) Xi effectively transitioned to Emperor Xi, (2) China
has begun to practice surveillance capitalism, both factors distasteful to
any rational person.
While I don’t want to come down too hard on the Chinese given their present
level of suffering, it must be said that, unlike Europe, China had never gone
through the Age of Enlightenment. As a result, the Chinese are extremely
superstitious. They actively believe in demons and evil spirits. Xi himself
referred to the coronavirus as a demon. They are obsessed with ghosts
(especially in Taiwan), e.g., Hungry Ghost festivals. They believe in nonsense
like Feng Shui. They are very superstitious about numbers in addresses
and license plates (4 is unlucky, 8 is lucky, etc). They take astrology and
fate a little too seriously. Then they bring their corrupt and superstitious ways
to the United States, Canada, Australia, and Europe.
We have the spectacle in the U.S. of Chinese women with advanced degrees
who insist on seeing an astrologer to determine the most auspicious wedding
date. All this needs to be put in the context of never-ending social climbing
and endless credential seeking. E.g., the Chinese in the U.S. are known
to make offerings to the money god, whoever that is, lol.
Enlightenment (or Age of Reason) took place within the context of
monotheism. God the Creator in Christianity is assumed to be rational,
and hence the creation is rational as well. Therefore reason (in addition
to revelation) is a reliable guide to reality. This type of attitude cleansed
Europe of all sorts of superstitious fears, esp. fear of witchcraft. This is what
China needs, and of course, that won’t happen.
What can China do in the meantime? The simplest thing would be to switch
to vegetarianism. Note that India, which is heavily vegetarian, is not known
as a major source of epidemics. Civilization requires extremely high levels
of cleanliness, something that China, unlike Japan, is apparently incapable
of.
In the long run, China (and the U.S.) needs to break up into several countries.
It’s well established that the happiest countries are small and homogeneous,
for many reasons, one being that people are closer to their rulers.
They sequenced its DNA very quickly, and it utilizes some similar protein to get into the cells. Which is why they thought some HIV antivirals would be effective. It doesn’t require a big conspiracy.
Uh-oh, so it really begins – perfectly healthy before 35 year old was hospitalised with pneumonia in USA from returning out of China.
https://edition.cnn.com/2020/01/31/health/washington-coronavirus-study-nejm/index.html
Sadly, it is looking more and more like true Black Swan event, just the rest of the world is about month or two behind China in this regard, what is happening there at the moment will be happening elsewhere after a month or so. Quarantines and shutdowns of a scale never seen in modern history before are coming. Those are absolutely uncharted waters. Life as usual will come to an end, then we will be entering something entirely else. All enjoy the “normal” remaining time while you can.
Looks like Mayans were off about 8 years with their ancient unreliable calendars, lol 🙂
So it’s just a means to improve the infection rate? No lifetime after-effects for your body’s immune system?
How charitable of them.
I believe every virus uses some sort of protein to get into the cells, since without getting there they are pretty helpless. I also don’t think the methods used by HIV aren’t unique to it either. And I think the similarity ends with that protein.
Of course it could turn out that it’s really a bioweapon, or something similar. As I said, I don’t know, and it’s certainly possible. I just don’t think it should be treated as a fact when it isn’t.
Just as perfect as it could be:
https://edition.cnn.com/2020/01/31/health/washington-coronavirus-study-nejm/index.html
Speaking of ability of different countries to deal with infections, it’s worth mentioning that China likely got its swine disease from Russia. Russia itself was infected by Georgia in 2007. And Georgia happens to host a secretive American biological research facility…
But my point is not to accuse Americans of infecting countries with swine fewer. I wanted to say that disease was no obstacle to Russia growing its pork production every year from 2007. Nothing close to Chinese devastation happened in this country.
btw, all the people posting here, can consider themselves to be better informed than 99% of the overall population, so have a little bit more time to prepare. Even if in the end many of us will probably get sick too and some will die, usual preparations out of classic “prepper” stuff can be done and will be useful, while paper money still have value, as very likely that at some point card rationing will be implemented.
I’ve been wondering, what percentage of antivirals were developed to treat STDs? And what were the R&D costs for STDs compared to the total?
I know that there would be some developed to treat flu, but my suspicion is that it is >90% STDs. Certainly, the gay lobby has focused an enormous amount of resources on AIDS. But then I think Hepatitis C would be another big one, as well as Herpes.
Is there any truth to the rumor that they unblocked porn torrents in certain cities to get people to stay at home?
Bats likely spread coronavirus, but don’t get sick
https://www.youtube.com/watch?v=py4ufHf9ZwY
Coronavirus, New contagion data
https://www.youtube.com/watch?v=OQFBUgDgG_k
Why don’t bats get sick? My first guess: Corona is adapted to replicate in bats, especially during hibernation when the animal’s temperature is lower (see White Noise Syndrome as a further example); it is winter in China now. Probably, some bat that should be hibernating was taken to a market where it passed the disease on to a worker or passerby. Humans, having a higher baseline body temperature than hibernating bats, take longer to present with symptoms because Corona is poorly-adapted to replicate at human body temperature. The virus replicates somewhat slowly and sheds before fever because it is adapted for replication and transmission at the lower temperatures seen in bats. This is, perhaps, somewhat indicated by a German man who presented with a high fever of 102F and cough but then quickly felt better the next day and went back to work where he infected others; Corona can’t handle the higher body temperature. Although, there are counterexamples in Asia where some patients had high fevers for days. Alternatives: there is something about the bat immune system we don’t understand; bat tissues are adapted in some way we don’t understand; bats, like ferrets and influenza, do indeed get sick, we just haven’t observed it.
The new coronavirus is quite similar to the SARS coronavirus. Research suggested that HIV meds could be potential treatment for SARS as early as in 2004. Some HIV meds seem to have broad-spectrum anti-coronavirus activities. So it’s no surprise at all that Chinese want to try HIV meds for this new coronavirus too.
https://www.ncbi.nlm.nih.gov/pubmed/15144898
A broad-spectrum anti-viral drug that was developed to treat Ebola (and failed) is also being repurposed for the new coronavirus. It doesn’t mean that the new coronavirus was created by genetic recombination with Ebola!
https://www.theverge.com/2020/1/31/21114176/coronavirus-treatments-universal-vaccines-china-outbreak
As for Zerohedge, it’s well known for spreading conspiracy theories. I won’t spend a second reading about the new coronavirus on their site.
Latest update. Very bad … if true.
I think maybe the government should consider suspending ALL inbound flights for 90 days. Also, perhaps deploy the military to guard the two borders, even with Canada considering their incompetent PM is still allowing inbound flights from China and refusing to declare an emergency. It might buy us time should the worst case scenario come to pass. If we can delay for 3 months, the FDA can rush out an experimental, untested vaccine — hopefully. Although, even that would be a miracle if we could pull it off.
So it’s basically asymptomatic superfast spreading SARS according to this model. Not surprised at all, this is not being contained and won’t be contained soon. As I said, prepare as much you can, it will be really really unprecedently (at least in modern times) bad.
Do the Russians know something the rest of us don’t?
https://m.dw.com/en/coronavirus-german-evacuation-flight-lands-in-frankfurt/a-52223609
Assuming that it’s true. Sounds bad.
Also something to consider that German doctors are already whining about being overstrained while having to deal with just 4 virus patients the what the hell will they do when having 40, then 400 or 4000 and so on which is more than possible with such fast spreading rates or even with initial lower rates? While possibly themselves dropping ill from the virus as Wuhan doctors?
https://www.nejm.org/doi/full/10.1056/NEJMc2001468
The paper has not been peer-reviewed yet. The “bright side” is that if it’s really that bad (approaching the severity of the SARS outbreak), then everyone will start self-quarantine, and that may well contain the spread of the infection unexpectedly.
At the price of shutting down the economy. How sustainable is such a self-quarantine?
China has already shut down its economy, resulting in a slower spread. But not zero. And they back it up with the force of law. There’s of course a fully fledged panic, too.
As to the paper, even if peer reviewed, it’s probably too early and the data too unreliable to know. It might be true, or it might not.
Lovelock and his Gaia hypothesis are both better known and more influential than high physics and any high physicist today. A lot of the global warming/climate change views that dominate elite and mainstream opinion derive from Lovelock and the Gaia hypothesis. Moreover, Gaia is much easier for people to understand and readily accessible, and conforms to most people’s folk views, even if physics is “simpler” in a certain mathematical sense. So I disagree with your view. Physics has taken a backseat to Lovelock inspired environmental biology since the 50s and 60s.
Lovelock is famous for making apocalyptic predictions about global warming. However, he has also reversed himself to a degree and said that global warming has not happened since 2000. He’s turned his attention to robots recently and said robots will take over the world in several decades.
Russia’s response to the swine fever epidemic was more intensive industrialized pig farming. Small pig farms and household pig farms were shut down, and pork production was concentrated into fewer industrial operations. While China still has many small scale pig farms.
China seems to be in a damned if it does, damned if it doesn’t situation. If it maintains decentralized small scale pig farming which is more vulnerable to outbreaks, it’ll be accused of being especially unsanitary. If it goes the more industrialized pig farming route, it’ll be attacked for the evils of industrialized farming.
https://www.scmp.com/news/china/politics/article/2176866/can-china-learn-russia-and-save-its-pigs-african-swine-fever
The economic impact might be a reduction of China’s economic growth rate from 6% to 4-4.5% in quarter 1 of 2020, and a reduction of growth rate from 6% to 5-5.5% in 2020.
I find it impossible to believe. It’s based on assumptions that the lockdown will end within a week, and limited to Hubei.
Those are the numbers for the daily new confirmed cases, i.e. (delta NConfirm)
Thus with rough estimation, NConfirm = integrate (delta NConfirm)
if as you asserted (delta NConfirm) = k1 * t
DeltaNConf = -4532.36 +216.46*Day; #n=6; Rsq=0.714; SEest=286.5; p=0.03417 * (Sig)
then NConfirm ~ k1*t^2 + k2; i.e. non linear.
https://i.ibb.co/tsGcFD9/gzbd.png
Mmm. Wrong top label. Too lazy to fix that.
The trouble of seeing only a small fraction of the curve, even the SARS logistic curve looks linear.
https://i.ibb.co/GsZCSZc/sarsln.png
fixed.
https://i.ibb.co/fSLRn5N/gzbd.png
You seem to have a lot of knowledge and the most thoughtful commentary I’ve read on this situation, so I have a few questions if you don’t mind.
Is it likely or typical that the virus mutates to a less lethal form in the course of the epidemic?
Can there be multiple strains with different characteristics in the same epidemic? Seems like that should be the case, but I don’t recall hearing of such a situation.
If it’s true that Han have an apparent vulnerability to this virus, does this mean that, e.g., the US , is going to much less vulnerable to a large scale epidemic taking hold? Seems like the answer would be obviously yes, but maybe mutation would quickly change that?
Given all the above, might it be the case that North America, etc., get through this round ok, but the virus is now in the human population in a big way, so we get hammered next year or the year after.
Thank you for any wisdom you can provide.
Yes, it’s obviously nonlinear after the data for 2/1/2020 was released: newly confirmed case on 2/1/2020 was 2602.
Well HIV medication is effective against Alzheimer’s so…..
Somewhat promising development at last? Antiviral serum extracted from recovered patient:
https://www.biorxiv.org/content/10.1101/2020.01.31.929042v1
But highest official Commie Chinese are getting really uneasy:
Not to mention it seems to have been spreading about a month earlier than official start, while being recorded as ordinary pneumonia deaths.
https://www.nzherald.co.nz/world/news/article.cfm?c_id=2&objectid=12305211
The more I try to read about original SARS while there is still no such kind publicly available data about this SARS 2.0, the more it looks to be capable of wreaking havoc, if assuming those capabilities are similar or quite probably even exceed old SARS:
This winter is quite warm with more or less such subzero temperatures, so the virus may survive even longer.
Also assuming that majority of people will isolate themselves in apartment buildings, this still might not stop the spread as even old symptomatic spreading SARS still managed infiltrate whole building and cause outbreak through water piping system.
https://www.irishtimes.com/news/sars-virus-can-survive-for-weeks-outside-body-who-1.475387
Reading more in detail reveals about this case, it was specific piping system with some malfunctions as well, but still imho it is more than concerning:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC539564/
So in short, as part of preparation you should be behaving as the virus is already there in your country and living place, no matter the lack of official confirmations and start wearing the gloves, facemask and safetyglasses when going outside. Will try to implement this myself while taking from tomorrow at least one week unpaid leave from job.
As a good news looks it can be killed quite quickly with the simple bleach so at least you can try to disinfenct the bottoms of your boots in home conditions.
I don’t know how easy it is for you to take unpaid vacations, but if it was limited, I would want to spare it for later. Staying at home should be done when there’s already a raging epidemic around you, because that’s when you don’t want to be outside at all. Using it up early while the danger is still low means that you’ll be helpless precisely when the danger will be the highest.
You’re right, just I am not planing to stay inside at all – at least the start of the week gonna spend part of my electronic money in a card while buying long term gas, food, water, basic drugs, ammo, additional medical protection stuff etc, cause I firmly believe there will be shortages sooner or later.
Then time for arranging/postponing/correcting some personal stuff and travel plans, some bureucratic paperworks etc, which also takes at least several days.
Also even started to contemplate to quiting the job altogether without much legal hasle and then taking unemployment benefits as they are relatively generous in Lithuania now (my calcs show nearly 600 EUR a month for me on average) and will be paid for next nine months.
Through that time this global clusterfuck certainly will unfold and either some miracle drugs would be produced and we will have some sort or happy ending or those survived from virus would begin to die from hunger as food producers will completely devastated too. Or just gonna collapse from the virus inside my house from the virus earlier than those two possibilities arrive, so such trivial thing as white collar work or social security either won’t matter for me or just dissapear completely for everybody as collapse deepens.
All this sense of impending doom is also fueled by first virus negative case in LT as this really means nothing as testing this new thing so far is not at all simple or reliable, so there really may be way much more infected people already:
https://www.businessinsider.com/tests-for-coronavirus-us-might-not-actually-work-cdc-says-2020-1?utm_source=reddit.com
I’m not fully convinced it’s going to result in an apocalypse of that proportions. It might still be some kind of overreaction by the Chinese, or they might still somehow stop it in its tracks. Apparently there is some success treating it with HIV and flu antiviral cocktails.
I don’t know if these results can be replicated, nor how easy it will be to scale up production of these antivirals, but there are things like that which should decrease mortality rates significantly.
https://www.scmp.com/news/asia/southeast-asia/article/3048629/coronavirus-thailand-has-apparent-treatment-success
Good news, maybe — sorta: Lancet reports R0 = ~2.7 as of 31 Jan. Not necessarily ~4. Still high, though. My guess: reports of 6.5% mortality are wildly overstated compared to baseline viral morality.
No non-Chinese outside of China have died so far, to my knowledge at least. The Philippine man who died may have been ethnically Chinese and a non-native who had traveled to China in recent days; others have been treated and released outside China. This makes me wonder if there is some underlying condition in China that’s increasing mortality above and beyond whatever baseline morality you’d expect from this virus: poor sanitation, poor nutrition among the old, environmental exposure (poor, homeless, hospital lines, etc.), or secondary bacterial complications due to lack of antibiotic prescription* … China is still partly a developing country, despite what many Westerners think.
Either that or the Chinese numbers are simply wrong. Presumably, it’s easier to notice the dead than the infected people who never showed symptoms or just stayed home and didn’t report illness. Maybe the true number of infected is far higher than expected and we are only noticing those who died, which would distort the results. This might exaggerate the mortality reported in a recent Chinese paper on the subject. Instead of 6.5%, which strikes me as way too high considering the few deaths occurring elsewhere, it could be ~1% minus complicating conditions, but that’s just a guess. Maybe it’s too early to tell.
In all, I feel more optimistic about Corona’s impact in the West as of this morning, as long as governments continue taking prudent steps such as temporary quarantines + maintain adequate stocks of antibiotics for secondary complications, PPE + undertake triage preparations to ensure efficient allocation of resources, etc. The third world, however, could be in for some trouble. We’ll see.
*The complication rate from Corona is reportedly high. What are Chinese doctors prescribing to those patients? Guess: China’s population is so large — and they waited so long to act — that maybe they are rationing antibiotics for complicating pneumonias and that, combined with their older population and poor sanitation practices (perhaps even in hospitals aside from patient practices), is worsening the mortality.
Thailand has quite a few recovered, encouraging the woman was seventy one too.
I think this can be contained, certainly in the developed world. The economic fallout still looks severe though.
Re: “Physics has taken a backseat to Lovelock inspired environmental biology
since the ‘50s and ‘60s”
You’ve got the dates wrong: Lovelock didn’t start publishing the Gaia model
until 1970. In the 1950s physicists were still regarded as heroes, complete
with invitations to the White House, because they helped to win the war.
After all it was the physicists (along with mathematicians and engineers)
who built nuclear weapons, developed radar, helped to develop first computers,
jet planes, lasers, transistors, microchips, etc The environmental consciousness,
at least in the U.S., didn’t begin to take hold until the publication of “Silent
Spring” by Rachel Carson in the mid-‘60s and The Whole Earth Catalogue
by Stewart Brand (he is still alive!) in the late ‘60s. The first Earth Day was
celebrated in 1970. Hippies were part of the Back-to-Nature movement. So,
true, environmentalism and life sciences in general began to overshadow
physics but not until the ‘70s. Physics became a victim of its own enormous
success, and started hitting the brick wall around 1980. “Physics has lost
its fizz,” as John Horgan of Scientific American stated.
Biomedical science problems are an order-of-magnitude tougher than problems
in physics and engineering. In turn, social problems are an order-of-magnitude
harder to solve than biomedical problem. The aerospace companies in California
designed and built rocket components that successfully landed on the moon in
the ‘60s and early ‘70s but today California in unable to solve its homelessness problem.
China is building high speed trains and tons of power plants because those are
easy physics and engineering challenges but is failing in solving its biomedical
problems (tainted food supply, incl. baby formulas, never-ending human and animal
epidemics, etc), and is a complete failure at solving its social problems (800 million
people irresponsibly added to its population, tens of millions dead during wars
and the Cultural Revolution, endemic corruption, failure to develop democracy,
failure to develop a superb legal system, practiced infanticide and mass abortion
producing an excess of males to females, recently introduced mass surveillance
and use of drones to control people – nightmarish dystopia if you are a rational
person).
I didn’t get the dates wrong. I know when Lovelock published Gaia.
The 50s and 60s were the height of optimism for physics. There was optimism for atomic energy and other atomic applications, and for space exploration. JFK began the effort in the early 60s to land on the moon. We made it to the moon in 1969, and that was the climax. Big physics pretty much stagnated and lost prestige and popularity since then. Lovelock started publishing the Gaia hypothesis the following year in 1970, and you also had the Limits to Growth studies coming out in the 70s, the energy crisis in the mid to late 70s, etc. Environmentalist pessimism took over and still dominates elite opinion and popular consciousness.
Your original argument was that environmentalism has had no influence and has been overshadowed by physics, which is false.
As for the rest of your comments, you seem to conflate a particular political and economic arrangement, namely modern liberal democracy coupled with austerity, as being “scientific”.
Isn’t that the opposite of what the article says?
Meaning, it survives worse in warm weather, which would seem like a good thing, with spring and summer just around the corner.
Yeah, but the problem seems to be this new thing is spreading in Australia just fine where temperatures at the moment are relatively hot.
Sooner or later we should get scientific studies about survival rates of this specific new virus.
The weather is one reason why it might not be so horrible – it’ll be spring by the time it arrives in Europe. There’s flu in August, some people do catch it (I had it in the summer once), but it’s rare, because the conditions for its spread are not ideal. And I don’t think it’s more contagious than the flu.
From the data it looks like there’s no self-sustained epidemic outside of China, though of course it’s possible that the Chinese travelers in Italy or the French doctor will change the picture rapidly.
Even in China, the growth of new cases outside Hubei has essentially stalled.
And both Hubei within China and China itself are closed off. There’s ground for optimism.
…but USA has more than doubled their cases though, even if from low initial number. Imho, German cases are the ones to watch now – if their condition will not progress to severe fevers and pneumonias (IIRC it was around 70% of all cases from first Lancet article) then it will be great news too.
The American cases seem to be recent travelers from China. The German cases are worrying in the sense that there could be similar cases in less competent countries. I doubt it would be caught if they didn’t test the first guy or the first two (both had contact with the Chinese woman), and let’s face it, they only looked suspicious because of their recent contact with the Chinese woman. A less meticulous doctor, or a doctor in a country where resources are scarcer, would not have tested for it.
The most likely route for the spread to the West still seems to be indirect, first spreading to third or second world countries, and then from there to the first world.
The apocalypse might get canceled:
https://www.scmp.com/news/china/society/article/3048732/china-starts-clinical-trials-new-antiviral-drug-treat
That might be really great, but still should wait for the overall USA recovery rates to appear, when at least those remaining 10 first infected will get sick enough too. Then it will be clear as that new drug is really universally effective as there is a slight unpleasant possibility that relatively young 35 yo man would have been one of those somehow recovered even in China without new drug.
btw, bought today about half the prepper stuff that planned to get while wearing facemask, protective gloves, glasses and another protective almost full face, but not fully closed, wearable on the head plastic mask. There were many glances, but nobody was freaking out, so it was not as bad as I thought it could be.
This French doctor might be the first confirmation that very mild Corona cases, not any different from simple flu, indeed do exist, if this is correctly translated:
from r/China_Flu/comments/eyavjo/phone_interview_of_the_infected_doctor_in_france/
Wow, 19,843 confirmed cases worldwide, including 426 fatalities.
http://recombinomics.co/thedrnimanshow/2020/02/020220.mp3
Oil continues to plunge.
The NConfirm count for NCov2019 doubled that for SARS in just 2 days.
https://i.ibb.co/x866rjN/jhuc2.png
There are reports that people with gene variant ACE.II are susceptable to
SARS. EAS have relatively higher frequency of ACE.II and hence more susceptable to SARS/NCoV2019. The global frequency distribution of the ACE.II genotype is given in https://dacemirror.sci-hub.se/journal-article/2768668d035fab00014da14f145c2d82/saab2007.pdf
ACE.II is also reported to reduce the Alzheimer Age-Onset AAO. So is there any relationshi
p between ACE.II and IQ? Yes, statistically very significant. So it is potentially a viable BioWMD against developed or high IQ nations like China or US.
https://i.ibb.co/zmMY3s7/aceiq.png
Internationally excluding China, there is statistically significant relationship between NConfirm and the GREquant score though not the GREverbal score.
https://i.ibb.co/jHdVsDs/corgre.png
For China, it seems that the higher the percentage of the provincial smart fraction the higher the NConfirm. NConfirm for ground zero Hubei is omitted as the very large value distorts the stats. Three of the provinces surrounding Huber have exceptional high NConfirm. Guangdong and Zhejiang are high tech provinces with lots of smart non-resident workers.
https://i.ibb.co/dpWJJFJ/ncovprov.png
The distribution of ACE.II variant as characterized by rs1877752.C from the gnomad dataset
Gnomad seems to differentiate the Fin from the European, thus “nfe” is non-Fin European. E
AS 98.1%, EUR 63.3%, AFR 44.5%
So the rough odd ratio OR of damage for EAS:EUR is 98:63, there might be considerable damage in case of blow-backs, especially the AFR:EUR OR of 44:63 for the alledged attacking nation which might drastically change the demographics of their country and hence the political balance. Will they be that stupid to do that?? Looking at the lose-lose situations of the trade wars, yes they might just be too stupid to do that.
The previous SARS the initial strain was reported to have higher OR for EAS but within days the OR was about even due to fast mutations. With current PC climate those reports seem to have vanished. There were simply too many Whites in HongKong or significant EAS in Canada for the pop SARS cross-overs to happen. Since NCoV2019 is similar to SARS, the same might happen.
Presymptomatic spread of the novel coronavirus might be fake news. In the German case the Chinese woman already had mild symptoms and she was taking fever-suppressing medications. As a result, her colleagues believed she was healthy.
The main driver of infections and probably symptomatic spread, people coughing and snoozing.
https://www.statnews.com/2020/02/04/high-profile-report-on-asymptomatic-spread-of-coronavirus-based-on-faulty-information-health-officials-say/
Flawed claim for sure, but if contagion with MILD symptoms is possible, it’s still bad news.
https://www.sciencemag.org/news/2020/02/paper-non-symptomatic-patient-transmitting-coronavirus-wrong
Well, so far, not that tragically bad – according to the doctor in charge, all 10 German patients merely show mild symptoms comparable to a common cold. If they won’t collapse out of nowhere during next week or so, coupled with that French doctor, it will seem that Asian(?) virus prefers Asian people more as a hosts for replicating itself uncontrollably.
Apparently it’s worse for Asians. But the vast majority of people survive it in China as well.
https://twitter.com/darkcityfm/status/1224521693064048641
By the way, while there could be natural reasons for this, the virus favoring Asians could strengthen the conspiracy theory of a biological attack on China.
Look at the previous SARS incidence in Canada. It is well known that EAS tend to live close together. Thus any EAS susceptible to SARS will catch it first. Any other spikes bigger and lagged the initial spike were most probably that SARS had spread to other populations. There were no major secondary spikes for China, HongKong, Macau or Taiwan.
https://i.ibb.co/RPwvX9C/sarsca.png
Maybe many have seen it already, but there was circulating plane seat schematic from SARS outbreak:
https://i.imgur.com/1votb3Q.png
Majority was not infected, but most astonishing fact that those two sitting at same the row did not contract the disease from the symptomatic patient, also do not see much of a very logical pattern, if based just on places alone. Perhaps walking down the aisle to the toilet during flight was involved too as touching toilet knobs, handles etc.
Also some bad news if true – virus already developing resistance to some preliminary treatments, more young people without health problems starting to die:
https://www.thailandmedical.news/news/latest-coronavirus-showing-resistance-to-earlier-antivirals,-seems-to-be-evolving
The foreign cases will be interesting. So far only two deaths.
https://twitter.com/nature/status/1225817544642174977
https://twitter.com/Cyranoski/status/1232900407623483393